Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
rno_circRNA_007512 | |||
Gene | DYM | Organism | Rat |
Genome Locus | chr18:70189468-70222968:+ | Build | n/a |
Disease | Neuropathic pain | ICD-10 | Hereditary and idiopathic neuropathy (G60) |
DBLink | Link to database | PMID | 28761373 |
Experimental Method | |||
Sample Type | Ipsilateral dorsal horn samples | Comparison | control rats and Rats underwent Craniocervical Instability (CCI) surgeries to induce neuropathic pain on the left hind limb. |
Method for Estimation | Quantitative PCR and Microarrays | PCR Details | |
Primers (Experimented) | Forward CCGGCACCTACAGTTCTGAC ReverseTGCAAACTGAAATGGTTGCCT | Statistics | Fold Change : Downregulated pvalue : p<0.05 |
Citation | |||
Cao, S, Deng, W, Li, Y, Qin, B, Zhang, L, Yu, S, Xie, P, Xiao, Z, Yu, T (2017). Chronic constriction injury of sciatic nerve changes circular RNA expression in rat spinal dorsal horn. J Pain Res, 10:1687-1696. |